Preview

Медицинская иммунология

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Online First ХЕМОКИНОВЫЕ МАРКЕРЫ, АССОЦИИРОВАННЫЕ С РАННИМ ОТТОРЖЕНИЕМ АЛЛОТРАНСПЛАНТАТА ПОЧКИ Аннотация  похожие документы
Татьяна Владимировна Федоренко, Наталья Владиславовна Колесникова, Ирина Анатольевна Пашкова, Владимир Алексеевич Порханов, Елена Александровна Губарева, Елена Вячеславовна Куевда
"... increase in pre-operative period as markers of acute kidney allograft rejection. When assessing changes ..."
 
Том 21, № 1 (2019) ОСОБЕННОСТИ ЭКСПРЕССИИ ХЕМОКИНОВЫХ РЕЦЕПТОРОВ CXCR3 И ССR6 И ИХ ЛИГАНДОВ В ПЕРИФЕРИЧЕСКОЙ КРОВИ БОЛЬНЫХ ХРОНИЧЕСКИМ ГЕПАТИТОМ С ВО ВРЕМЯ ПРОВЕДЕНИЯ ПРОТИВОВИРУСНОЙ ТЕРАПИИ С ИСПОЛЬЗОВАНИЕМ ПЕГИЛИРОВАННЫХ ИНТЕРФЕРОНОВ Аннотация  PDF (Rus)  похожие документы
В. В. Басина, Н. А. Арсентьева, О. К. Бацунов, Н. Е. Любимова, А. В. Семенов, Е. В. Эсауленко, Арег А. Тотолян
"... , CCL20/MIP-3α, CXCL9/MIG, CXCL10/IP-10, CXCL11/ITAC) were measured in blood plasma samples, using xMAP ..."
 
Том 10, № 4-5 (2008) ЭКСПРЕССИЯ мРНК ХЕМОКИНОВ И ХЕМОКИНОВЫХ РЕЦЕПТОРОВ В КОЖЕ БОЛЬНЫХ ПСОРИАЗОМ Аннотация  PDF (Rus)  похожие документы
А. С. Бельтюкова, К. А. Сысоев, Т. Н. Ильина, Т. Г. Шемеровская, М. М. Хобейш, К. Н. Монахов, Арег А. Тотолян
"... chemokines was performed: CCL3/MIP-1α, CCL4/MIP-1β, CCL5/RANTES, CCL11/eotaxin, CCL24/eotaxin-2, CXCL8/IL-8 ..."
 
Том 20, № 4 (2018) РОЛЬ МЕЗЕНХИМАЛЬНЫХ МУЛЬТИПОТЕНТНЫХ СТРОМАЛЬНЫХ КЛЕТОК В РЕМОДЕЛИРОВАНИИ КОСТНОЙ ТКАНИ Аннотация  PDF (Rus)  похожие документы
М. В. Киселевский, Н. Ю. Анисимова, Ю. И. Должикова, Р. Я. Власенко, Ф. С. Сенатов, А. В. Караулов
"... rejection of implanted tissue engineering designs, but it can also influence the bone tissue immunity. MSCs ..."
 
Том 13, № 6 (2011) ЭКСПРЕССИЯ мРНК НЕКОТОРЫХ ХЕМОКИНОВ И ИХ РЕЦЕПТОРОВ В СЛИЗИСТОЙ ОБОЛОЧКЕ НОСОГЛОТКИ У ПРАКТИЧЕСКИ ЗДОРОВЫХ ЛИЦ Аннотация  PDF (Rus)  похожие документы
А. А. Бибкова, К. А. Сысоев, А. В. Семенов, Н. Е. Любимова, Н. А. Арсентьева, В. И. Трофимов, Арег А. Тотолян
"...   that  ensured  the chemotaxis of neutrophils (CXCL8/IL-8), eosinophils (CCL11/eotaxin,  CCL24/eotaxin-2 ..."
 
Том 18, № 3 (2016) ДИНАМИЧЕСКИЕ ИЗМЕНЕНИЯ ХЕМОКИНА CXCL-10 (IP-10) У ДЕТЕЙ И ПОДРОСТКОВ, БОЛЬНЫХ РАЗЛИЧНЫМИ ФОРМАМИ ТУБЕРКУЛЕЗА ОРГАНОВ ДЫХАНИЯ Аннотация  PDF (Rus)  похожие документы
М. М. Авербах (мл.), Л. В. Панова, М. Ф. Губкина
"... CXCL10 (IP-10) chemokine is one of additional humoral markers applied along with determination ..."
 
Том 20, № 2 (2018) РОЛЬ ФАКТОРОВ ВРОЖДЕННОГО ИММУНИТЕТА В ПРОЦЕССЕ ОПУХОЛЕОБРАЗОВАНИЯ Аннотация  PDF (Rus)  похожие документы
О. А. Свитич, А. Б. Филина, Н. В. Давыдова, Л. В. Ганковская, В. В. Зверев
"... and their receptors have a great influence on the cancer development. It is shown that CCL2, CCL4, CCL17, CCL22 ..."
 
Том 18, № 6 (2016) ОСОБЕННОСТИ ХЕМИЛЮМИНЕСЦЕНЦИИ НЕЙТРОФИЛОВ ПЕРИФЕРИЧЕСКОЙ КРОВИ У ОНКОУРОЛОГИЧЕСКИХ БОЛЬНЫХ В ДИНАМИКЕ ЗАБОЛЕВАНИЯ Аннотация  PDF (Rus)  похожие документы
Л. М. Куртасова, Р. А. Зуков, Э. В. Семенов
"... , reactive oxygen species, kidney cancer, bladder cancer, oncourology Введение Онкоурологические заболевания ..."
 
Том 20, № 2 (2018) ОСОБЕННОСТИ ФЕНОТИПА ДЕНДРИТНЫХ КЛЕТОК, ДИФФЕРЕНЦИРОВАННЫХ ИЗ МОНОЦИТОВ КРОВИ, У БОЛЬНЫХ РАКОМ ПОЧКИ Аннотация  PDF (Rus)  похожие документы
А. А. Савченко, А. Г. Борисов, И. В. Кудрявцев, И. И. Гвоздев, А. В. Мошев
"... ) differentiated from peripheral blood monocytes in patients with kidney cancer (KC). The study involved 28 ..."
 
Online First ЗАВИСИМОСТЬ ФЕНОТИПА ДЕНДРИТНЫХ КЛЕТОК ОТ СОДЕРЖАНИЯ ПРОВОСПАЛИТЕЛЬНЫХ МОНОЦИТОВ КРОВИ У БОЛЬНЫХ РАКОМ ПОЧКИ Аннотация  похожие документы
Андрей Анатольевич Савченко, Александр Геннадьевич Борисов, Игорь Владимирович Кудрявцев, Антон Викторович Мошев
"... differentiated from monocytes on the number of pro-inflammatory monocytes in the blood of patients with kidney ..."
 
Том 17, № 1 (2015) УРОВНИ ИНТЕРЛЕЙКИНОВ 6 И 10 В КРОВИ И МАРКЕРЫ ОСТРОГО ПОВРЕЖДЕНИЯ ПОЧЕК В КРОВИ И МОЧЕ ПРИ ОСТРОМ КОРОНАРНОМ СИНДРОМЕ Аннотация  PDF (Rus)  похожие документы
М. А. Шаленкова, З. Д. Михайлова, П. Ф. Климкин, Э. Т. Манюкова
"... Certain correlations between changes of cytokine levels and kidney dysfunction, as well ..."
 
Том 19, № 6 (2017) ОСОБЕННОСТИ РАСПРЕДЕЛЕНИЯ АЛЛЕЛЕЙ И ГЕНОТИПОВ HLA-G 3’UTR 14-bp ins/del У ЖЕНЩИН, ИМЕЮЩИХ ДЕТЕЙ С ВРОЖДЕННЫМИ ПОРОКАМИ СЕРДЦА ИЛИ РЕПРОДУКТИВНЫЕ ПОТЕРИ В РАННИЕ СРОКИ ГЕСТАЦИИ Аннотация  PDF (Rus)  похожие документы
А. В. Шабалдин, А. В. Цепокина, С. А. Шмулевич, А. В. Понасенко, П. М. Крюков, Е. В. Шабалдина
"... and expression of specific mRNA and, thereby, efficiency of immune rejection blockade of the semi-allogeneic ..."
 
Том 20, № 5 (2018) АНАЛИЗ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ ХЕМОКИНОВ, ИХ РЕЦЕПТОРОВ, ГЕНОВ БЕЛКОВ ОСТРОЙ ФАЗЫ ВОСПАЛЕНИЯ И ГЕНА CD4 ПРИ ФОРМИРОВАНИИ ОЖИРЕНИЯ У ЖЕНЩИН Аннотация  PDF (Rus)  похожие документы
О. В. Кочетова, Л. З. Ахмадишина, Г. Ф. Корытина, Т. В. Викторова
"... encoding chemokines (CXCL12 rs1801157, CCL2 rs1024611), chemokine receptors (CCR5 del32, CX3CR1 rs3732378 ..."
 
Том 16, № 2 (2014) СОДЕРЖАНИЕ АНГИОГЕННЫХ И АНГИОСТАТИЧЕСКИХ ХЕМОКИНОВ В СИНОВИАЛЬНОЙ ЖИДКОСТИ В НОРМЕ Аннотация  PDF (Rus)  похожие документы
Д. А. Жебрун, А. Л. Маслянский, А. Г. Титов, А. П. Патрухин, А. А. Костарева, Н. А. Арсентьева, Н. Е. Любимова, А. В. Семенов, Арег А. Тотолян
"... /эотаксин, CCL24/эотаксин-2, CCL26/эотаксин-3, CCL21/ SLC, CXCL1-3/Gro, CXCL5/ENA78, CXCL6/ GCP-2, CXCL7 ..."
 
Том 15, № 3 (2013) ХРОНИЧЕСКАЯ КРАПИВНИЦА В ДЕТСКОМ ВОЗРАСТЕ. ИММУНОПАТОЛОГИЯ ХРОНИЧЕСКОЙ КРАПИВНИЦЫ У ДЕТЕЙ (ЧАСТЬ I) Аннотация  PDF (Rus)  похожие документы
Н. А. Синельникова, Н. М. Калинина, Н. Д. Савенкова
"... .g., CCL2, CХCL8, IL-1, IL-4, IL-6, IL-10, IL-13, IL-17, is observed during chronic inflammatory reactions ..."
 
Том 15, № 6 (2013) ОПРЕДЕЛЕНИЕ мРНК АНГИОГЕННЫХ И АНГИОСТАТИЧЕСКИХ ХЕМОКИНОВ И ИХ РЕЦЕПТОРОВ В СИНОВИАЛЬНОЙ ОБОЛОЧКЕ МЕТОДОМ КОЛИЧЕСТВЕННОЙ ПЦР В РЕАЛЬНОМ ВРЕМЕНИ Аннотация  PDF (Rus)  похожие документы
Д. А. Жебрун, А. Л. Маслянский, А. Г. Титов, А. П. Патрухин, А. А. Костарева, И. С. Гольцева, Арег А. Тотолян
"... ,  CCL11/эотаксин,  CCL2/MCP-1,  CXCL10/IP-10,  CCL4/MIP-1b,  CCL5/RANTES,  и  гомеостатические,  такие ..."
 
Том 11, № 6 (2009) ДЕЙСТВИЕ МОДУЛЯТОРОВ АКТИВНОСТИ МЕВАЛОНАТНОГО БИОХИМИЧЕСКОГО ПУТИ НА РЕАКТИВНОСТЬ МАКРОФАГОВ ПРИ ЭКСПЕРИМЕНТАЛЬНОМ НЕФРОСКЛЕРОЗЕ Аннотация  PDF (Rus)  похожие документы
Я. Ш. Шварц, С. Н. Белогородцев, П. Н. Филимонов, Г. В. Селедцова
"... biochemical characteristics of kidney function derangements, and histological parameters of tissue alterations ..."
 
Том 16, № 5 (2014) РОЛЬ Т-РЕГУЛЯТОРНЫХ КЛЕТОК (Тreg) В ИММУНОМОДУЛЯЦИИ, АССОЦИИРОВАННОЙ С ТРАНСФУЗИЯМИ ГЕМОКОМПОНЕНТОВ (ОБЗОР ЛИТЕРАТУРЫ) Аннотация  PDF (Rus)  похожие документы
Т. В. Глазанова, О. Е. Розанова, Л. Н. Бубнова
"... трансплантату, и этот процесс может при- вести к его отторжению [2]. В 1970-х годах появились данные, свидетель ..."
 
Том 12, № 1-2 (2010) РОЛЬ МАКРОФАГОВ В РЕГУЛЯЦИИ ПРОЦЕССА МИГРАЦИИ ЕМОПОЭТИЧЕСКИХ СТВОЛОВЫХ КЛЕТОК В СИСТЕМЕ КОСТНЫЙ МОЗГ – ПЕРИФЕРИЧЕСКАЯ КРОВЬ Аннотация  PDF (Rus)  похожие документы
Б. Г. Юшков, И. Г. Данилова, И. А. Пашнина, И. А. Брыкина, М. Т. Абидов
"... and kidney injury under stimulation of phagocyte mononuclear system by injection of tamerit. This study have ..."
 
Online First Роль хемокинового рецептора CXCR3 и его лигандов при некоторых иммунопатологических состояниях Аннотация  похожие документы
Наталья Александровна Арсентьева, Александр Владимирович Семенов, Дарья Анатольевна Жебрун, Елена Викторовна Васильева, Арег Артемович Тотолян
"... ligands have a wide range of functional activity. CXCR3 ligands are IFNγ-indused chemokines: CXCL9, CXCL10 ..."
 
Том 14, № 1-2 (2012) ЗНАЧИМОСТЬ ОПРЕДЕЛЕНИЯ НЕКОТОРЫХ ХЕМОКИНОВ И ИХ РЕЦЕПТОРОВ У БОЛЬНЫХ БРОНХИАЛЬНОЙ АСТМОЙ Аннотация  PDF (Rus)  похожие документы
А. А. Бибкова, К. А. Сысоев, А. В. Семенов, Н. С. Любимова, Н. А. Арсентьева, В. И. Трофимов, Арег А. Тотолян
"... /эотаксина-2, CXCL8/ IL-8, CCL5/RANTES, CCL3/MIP-1α, CCL4/ MIP-1β) и мРНК хемокиновых рецепторов (CCR1, CCR3 ..."
 
Том 18, № 6 (2016) РОЛЬ РАЗЛИЧНЫХ СУБПОПУЛЯЦИЙ CD4+Т-ЛИМФОЦИТОВ ПРИ БЕРЕМЕННОСТИ Аннотация  PDF (Rus)  похожие документы
Д. И. Соколов, О. И. Степанова, С. А. Сельков
"... particular, CXCL9, CXCL10, CXLC11 and CCL5, is disturbed [83]. It is thought that in this way Th1 cell ..."
 
Online First ВЛИЯНИЕ ПРОТИВООПУХОЛЕВЫХ АНТИБИОТИКОВ АНТРАЦИКЛИНОВОГО РЯДА НА ТРАНСКРИПЦИОННУЮ АКТИВНОСТЬ РАКОВО-ТЕСТИКУЛЯРНЫХ АНТИГЕНОВ В МОДЕЛЬНОМ ЭКСПЕРИМЕНТЕ НА КЛЕТОЧНОЙ ЛИНИИ HELA Аннотация  похожие документы
Денис Сергеевич Кутилин, Хава Ахмедовна Могушкова
"... upon transcriptional profile of 17 cancer-testicular (CT) genes of HeLa CCL-2 cells. A long-term line ..."
 
Том 21, № 3 (2019) ВЛИЯНИЕ ПРОТИВООПУХОЛЕВЫХ АНТИБИОТИКОВ АНТРАЦИКЛИНОВОГО РЯДА НА ТРАНСКРИПЦИОННУЮ АКТИВНОСТЬ РАКОВО-ТЕСТИКУЛЯРНЫХ АНТИГЕНОВ В МОДЕЛЬНОМ ЭКСПЕРИМЕНТЕ НА КЛЕТОЧНОЙ ЛИНИИ HeLa Аннотация  PDF (Rus)  похожие документы
Д. С. Кутилин, Х. А. Могушкова
"... upon transcriptional profile of 17 cancer-testicular (CT) genes of HeLa CCL-2 cells. A long-term line ..."
 
Том 12, № 3 (2010) КОРРЕКЦИЯ АУТОИММУННОГО ГЛОМЕРУЛОНЕФРИТА У ЭКСПЕРИМЕНТАЛЬНЫХ ЖИВОТНЫХ ЛЕТАЛЬНЫМ ОБЛУЧЕНИЕМ И ПЕРЕНОСОМ КЛЕТОК СИНГЕННОГО КОСТНОГО МОЗГА Аннотация  PDF (Rus)  похожие документы
О. Т. Кудаева, Е. В. Гойман, Е. В. Ненашева, И. В. Майбородин, О. П. Колесникова, В. А. Козлов
"... , and inflammatory reaction was found to be decreased in the kidneys of animals with lupus-like disorder after marrow ..."
 
Том 18, № 3 (2016) ХЕМОКИНОВЫЕ РЕЦЕПТОРЫ НА Т-ХЕЛПЕРАХ РАЗЛИЧНОГО УРОВНЯ ДИФФЕРЕНЦИРОВКИ: ОСНОВНЫЕ СУБПОПУЛЯЦИИ Аннотация  PDF (Rus)  похожие документы
И. В. Кудрявцев, А. Г. Борисов, И. И. Кробинец, А. А. Савченко, М. К. Серебрякова, Арег А. Тотолян
"... . Лигандами для CCR4 выступают CCL17, экспрессируемый эндотелиальными клетка- ми микроциркуляторного русла ..."
 
Том 17, № 3s (2015) ПАТОГЕНЕЗ, ДИАГНОСТИКА И ИММУНОТЕРАПИЯ ИММУНОПАТОЛОГИЧЕСКИХ СОСТОЯНИЙ. ИММУНОЛОГИЯ ВИЧ-ИНФЕКЦИИ И ВИРУСНЫХ ГЕПАТИТОВ Аннотация  PDF (Rus)  похожие документы
Статья Редакционная
"... /MIP-1α, CCL4/MIP-1β, CCL8/MCP-2, CCL20/MIP-3α, CXCL9/ MIG, CXCL10/IP-10, CXCL11/ITAC, в плазме крови ..."
 
Том 17, № 6 (2015) ИММУНОБИОЛОГИЯ ОСТРОЙ РЕАКЦИИ «ТРАНСПЛАНТАТ ПРОТИВ ХОЗЯИНА» Аннотация  PDF (Rus)  похожие документы
Г. А. Ефимов, А. С. Вдовин, А. А. Григорьев, С. Ю. Филькин, Н. А. Быкова, В. Г. Савченко
"... , которые могут вызвать отторжение трансплантата и по- давление кроветворения реципиента. Органы ..."
 
Том 20, № 4 (2018) ПУРИНЕРГИЧЕСКАЯ РЕГУЛЯЦИЯ ОСНОВНЫХ ФИЗИОЛОГИЧЕСКИХ И ПАТОЛОГИЧЕСКИХ ПРОЦЕССОВ Аннотация  PDF (Rus)  похожие документы
А. С. Головкин, И. А. Асадуллина, И. В. Кудрявцев
"... и неинфекционного воспаления, опухолевого роста и метастазирования, реакций отторжения трансплантата ..."
 
Том 16, № 2 (2014) ИММУНОМОДУЛИРУЮЩАЯ АКТИВНОСТЬ МЕЗЕНХИМАЛЬНЫХ СТРОМАЛЬНЫХ (СТВОЛОВЫХ) КЛЕТОК Аннотация  PDF (Rus)  похожие документы
В. Б. Климович
"... , не вызывают реакции отторжения. Они без иммуносупрессии приживаются в месте инъекции, сохраняя спо ..."
 
Online First РОЛЬ Т-РЕГУЛЯТОРНЫХ КЛЕТОК В ПРОГРЕССИРОВАНИИ РАКА ПРЕДСТАТЕЛЬНОЙ ЖЕЛЕЗЫ. Аннотация  похожие документы
Сергей Валерьевич Хайдуков
"... клетки или макрофаги в опухоли способны секретировать хемокин CCL22, который обладает сродством к ..."
 
Том 8, № 5-6 (2006) АУТОАНТИТЕЛА К ДНК В СЫВОРОТКЕ КРОВИ БОЛЬНЫХ ГЕМОРРАГИЧЕСКОЙ ЛИХОРАДКОЙ С ПОЧЕЧНЫМ СИНДРОМОМ Аннотация  PDF (Rus)  похожие документы
Д. Д. Ишмухаметова, Б. К. Темесген, О. В. Власова, Ф. А. Бабушкина
"... to denatured DNA. AAbs to denatured DNA autoantibodies may participate in inflammatory destruction of kidney ..."
 
Том 13, № 2-3 (2011) ОСОБЕННОСТИ МЕСТНОГО СИНТЕЗА мРНК НЕКОТОРЫХ СС- И СХС-ХЕМОКИНОВ И ИХ РЕЦЕПТОРОВ ПРИ ГИПЕРПЛАЗИИ ЭНДОМЕТРИЯ Аннотация  PDF (Rus)  похожие документы
Н. В. Кипич, Н. В. Кулагина, А. Б. Чухловин, К. А. Сысоев, Арег А. Тотолян
"... / CCL24 CACATCATCCCTACGGGCTCT GGTTGCCAGGATATCTCTGGACAGGG 288 60 IL-8/CXCL8 GTGGCTCTCTTGGCAGCCTTCCTGAT ..."
 
Том 21, № 2 (2019) НЕКОТОРЫЕ АСПЕКТЫ ИСПОЛЬЗОВАНИЯ АЛЛО- И КСЕНОГРАФТНЫХ МОДЕЛЕЙ ПРИ РАЗРАБОТКЕ ПРОТИВОРАКОВЫХ ВАКЦИН И ОНКОЛИТИЧЕСКИХ ВИРУСОВ Аннотация  PDF (Rus)  похожие документы
Т. С. Непомнящих, Е. В. Гаврилова, Р. А. Максютов
"... мышей, а также с развитием реакции отторжения трансплантата. Таким образом при планировании ..."
 
Том 20, № 6 (2018) РОЛЬ CD200/CD200R-ВЗАИМОДЕЙСТВИЯ В ФОРМИРОВАНИИ ИММУНОЛОГИЧЕСКОЙ ТОЛЕРАНТНОСТИ ПРИ ТРАНСПЛАНТАЦИИ И БЕРЕМЕННОСТИ Аннотация  PDF (Rus)  похожие документы
А. С. Арефьева, А. А. Бабаян, Е. О. Степанова, Т. В. Донцова, С. В. Павлович, Л. В. Кречетова, М. А. Николаева
"... отторжения. Толерогенный потенциал взаимодействия молекул CD200 и CD200R может быть эффективно использован ..."
 
Том 19 (2017): СПЕЦВЫПУСК АУТОИММУННЫЕ ЗАБОЛЕВАНИЯ Аннотация  PDF (Rus)  похожие документы
Редакционная статья
"... , CCL2/MCP-1, CCL8/MCP-2, CCL20/MIP- 3α, CXCL9/MIG, CXCL10/IP-10 и CXCL11/I-TAC. Результаты. В плазме ..."
 
Том 7, № 5-6 (2005) ПРИРОДА АЛЛОГЕННОГО ОТВЕТА Аннотация  PDF (Rus)  похожие документы
Д. Б. Казанский
"... вторичном ответе, который тестировали через 6 недель после отторжения аллотрансплантата [5, 6]. В ..."
 
Том 18, № 2 (2016) КУЛЬТУРА ФИБРОБЛАСТОПОДОБНЫХ СИНОВИАЛЬНЫХ КЛЕТОК БОЛЬНЫХ РЕВМАТОИДНЫМ АРТРИТОМ: СВОЙСТВА И ВОЗМОЖНОСТИ Аннотация  PDF (Rus)  похожие документы
М. А. Шнайдер, В. С. Ширинский, И. В. Ширинский
"... repeated culture passages. Some promoters of genes involved into RA pathogenesis (for example, CXCL12, IL-6 ..."
 
Том 16, № 6 (2014) ВЛИЯНИЕ ИНГАРОНА НА ИММУННЫЙ СТАТУС БОЛЬНЫХ АДЕНОКАРЦИНОМОЙ ЛЕГКОГО В ПРОЦЕССЕ АДЪЮВАНТНОГО ЛЕЧЕНИЯ Аннотация  PDF (Rus)  похожие документы
С. П. Пыльцин, Е. Ю. Златник, Ю. Н. Лазутин, Г. З. Сергостьянц, Г. И. Закора, И. А. Лейман, П. А. Анистратов
"... индуцированных опухолей мы- шей, как предполагается, вызывает отторжение опухоли опосредованно через повышение ..."
 
Том 13, № 2-3 (2011) СОДЕРЖАНИЕ ЦИТОКИНОВ В ПЛАЗМЕ КРОВИ БОЛЬНЫХ, НАХОДЯЩИХСЯ НА ХРОНИЧЕСКОМ ГЕМОДИАЛИЗЕ Аннотация  PDF (Rus)  похожие документы
Д. С. Поляков, О. М. Домашенко, П. В. Белобородов, К. А. Сысоев, М. М. Шавловский, Арег А. Тотолян
"... Аbstract.  Patients  with  end-stage  renal  disease  need  their  kidney  functions ..."
 
Том 18, № 3 (2016) НЕФРИТОГЕННОСТЬ IgA-СВЯЗЫВАЮЩИХ STREPTOCOCCUS PYOGENES. МОДЕЛИРОВАНИЕ IgA-ГЛОМЕРУЛОНЕФРИТА Аннотация  PDF (Rus)  похожие документы
Л. А. Бурова, П. В. Пигаревский, В. А. Снегова, Н. В. Дуплик, Клаас Шален, Артем А. Тотолян
"... were completely absent in kidneys of control animals. Taken together, these data suggest that we have ..."
 
Том 16, № 6 (2014) МЕХАНИЗМЫ ДЕЙСТВИЯ ВИТАМИНА D НА ИММУННУЮ СИСТЕМУ Аннотация  PDF (Rus)  похожие документы
С. А. Снопов
"... - сорными клетками за их роли в предупреждении аутоиммунных реакций, например, в препят- ствии отторжению ..."
 
Том 18, № 3 (2016) ОСОБЕННОСТИ ВЗАИМОСВЯЗИ ФЕНОТИПА И ХЕМИЛЮМИНЕСЦЕНТНОЙ АКТИВНОСТИ НЕЙТРОФИЛЬНЫХ ГРАНУЛОЦИТОВ У БОЛЬНЫХ РАКОМ ПОЧКИ Аннотация  PDF (Rus)  похожие документы
А. А. Савченко, А. Г. Борисов, А. А. Модестов, И. В. Кудрявцев, А. В. Мошев, И. И. Гвоздев, О. Г. Тоначева
"... and «respiratory burst» of neutrophils may specifically characterize immunopathogenesis of kidney cancer and can ..."
 
Том 14, № 3 (2012) ФЕНОТИПИЧЕСКАЯ ХАРАКТЕРИСТИКА CD4+Т-ЛИМФОЦИТОВ ПЕРИФЕРИЧЕСКОЙ КРОВИ ПРИ ФИЗИОЛОГИЧЕСКОЙ БЕРЕМЕННОСТИ И ПРИ ГЕСТОЗЕ Аннотация  PDF (Rus)  похожие документы
В. А. Михайлова, Я. С. Онохина, О. М. Овчинникова, М. И. Мирашвили, М. С. Зайнулина, С. А. Сельков, Д. И. Соколов
"... к SDF-1), CD119 (рецептор к IFNγ), CD192 (рецептор к MCP-1), CD197 (ре- цептор к CCL19 и CCL21 ..."
 
Том 15, № 3 (2013) ВЛИЯНИЕ ФАКТОРОВ, СЕКРЕТИРУЕМЫХ ТКАНЬЮ ПЛАЦЕНТЫ, НА СЕКРЕЦИЮ ЦИТОКИНОВ МОНОЦИТОПОДОБНОЙ ЛИНИЕЙ КЛЕТОК ТНР-1 Аннотация  PDF (Rus)  похожие документы
Я. С. Онохина, Т. Ю. Львова, Д. З. Цицкарава, С. А. Сельков, Д. И. Соколов
"... - риферической крови. Под действием продуциру- емых клетками трофобласта хемокинов (MIP- 1α, CXCL16) моноциты ..."
 
Том 11, № 2-3 (2009) γδТ-ЛИМФОЦИТЫ: ОБЩАЯ ХАРАКТЕРИСТИКА, СУБПОПУЛЯЦИОННЫЙ СОСТАВ, БИОЛОГИЧЕСКАЯ РОЛЬ И ФУНКЦИОНАЛЬНЫЕ ОСОБЕННОСТИ Аннотация  PDF (Rus)  похожие документы
Д. Б. Нижегородова, М. М. Зафранская
"... рецептор CCR9 и мигрируют в ответ на хемокин CCL25/TECK. Миграция Т-лимфоцитов в кожу опосредована ..."
 
Том 21, № 1 (2019) ТРОМБОЦИТЫ КАК АКТИВАТОРЫ И РЕГУЛЯТОРЫ ВОСПАЛИТЕЛЬНЫХ И ИММУННЫХ РЕАКЦИЙ. ЧАСТЬ 2. ТРОМБОЦИТЫ КАК УЧАСТНИКИ ИММУННЫХ РЕАКЦИЙ Аннотация  PDF (Rus)  похожие документы
Н. Б. Серебряная, С. Н. Шанин, Е. Е. Фомичева, П. П. Якуцени
"... of the TNF superfamily (TRAIL and LIGHT), the SDF-1 chemokine (CXCL12), the IL-1βinterleukins, IL-8 ..."
 
Том 18, № 6 (2016) ХАРАКТЕРИСТИКА ПРОФИЛЯ ПРОВОСПАЛИТЕЛЬНЫХ ЦИТОКИНОВ У БОЛЬНЫХ С РАЗЛИЧНЫМИ ФЕНОТИПАМИ АЛЬФА-1-АНТИТРИПСИНА Аннотация  PDF (Rus)  похожие документы
М. Ю. Первакова, С. В. Лапин, Е. А. Суркова, О. Ю. Ткаченко, А. И. Будкова, В. И. Гусева, О. Н. Титова, В. Л. Эмануэль, Арег А. Тотолян
"... гиперреактивность бронхов и ре- зистентность к ГКС [12], связан с отторжением трансплантата легкого у мышей [31] и ..."
 
Том 11, № 4-5 (2009) ПАТОГЕНЕЗ, ДИАГНОСТИКА И ИММУНОТЕРАПИЯ ИММУНОПАТОЛОГИЧЕСКИХ СОСТОЯНИЙ. АУТОИММУННЫЕ ЗАБОЛЕВАНИЯ Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... (IL-6, IL-13), хемокинов (CCL11/Еotaxin, CCL4/MIP-1β, CCL7/MCP-3, CCL27/ CTACK, CXCL1/GROα, CXCL9/MIG ..."
 
Том 16, № 2 (2014) ИММУНОПАТОГЕНЕЗ ПСОРИАЗА И ПСОРИАТИЧЕСКОГО АРТРИТА Аннотация  PDF (Rus)  похожие документы
С. В. Смирнова, М. В. Смольникова
"... клетки TH17клетки IL-23 IL-19 IL-20 IL-24 IL-26 Кровеносный сосуд Mon CCL20 CXCL9 CXCL10 CXCL11 TNF ..."
 
1 - 50 из 138 результатов 1 2 3 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)